Virus Harvesting and Concentration

This protocol is adapted from a procedure used to isolate human AdV5 from culture medium (14). Except for centrifugation steps, where solutions containing virus are in sealed containers, all work is carried out in a class II biohazard cabinet.

1. After CPE has developed, medium is transferred to conical-bottomed centrifuge tubes (Nalgene 175-mL or Corning 50-mL, depending on the scale of the virus preparation) and floating, intact cells are removed by centrifugation at 1300g for 10 min. Retain the supernatant and hold it at room temperature. Any cell pellet may be combined with other residual cells (see Note 1).

2. Measure the total volume of cell culture medium in the conical bottom centrifuge tubes. Weigh out (NH4)2SO4 (242.3 g for each L of medium), add it to the liquid, and mix thoroughly to achieve a saturation of 40%. Incubate the mixture at room temperature for at least 2 h with occasional gentle mixing by inversion to allow the precipitate to form (see Note 2).

3. Centrifuge to recover the pellet containing virus (1600g for 15 min). Pour off the supernatant and gently dissolve the pellet in a minimal volume of PBS. Because the supernatant may contain some residual virus, treat with 0.2-2% bleach for 30 min at room temperature before discarding.

3.4. Purification of OAdV by Ultracentrifugation

1. The virus is first fractionated by velocity centrifugation on CsCl step gradients. Each step gradient can accommodate 4.5 mL of crude virus concentrate. Add 2.5 mL of 1.25 g/cm3 CsCl to a Beckman Ultraclear centrifuge tube (14 x 89 mm for the SW41 rotor), then underlay it with 2.5 mL of 1.35 g/cm3 and 2 mL of 1.5 g/cm3 solution using a 5-mL pipet with the Pipet Aid set on "slow." Carefully layer the crude virus concentrate on top using a sterile Pasteur pipet. Centrifuge in a Beckman ultracentrifuge using an SW41 rotor at 35,000 rpm (151,000g) for 2 h at 4oC. Balance opposing buckets to within 5 mg.

2. The viral band (the lowest band in the gradient, usually about halfway down) is best viewed against a black background. Mark its position on the tube and carefully remove the overlying solution with a sterile Pasteur pipet. Recover the viral band in a minimal amount of CsCl solution.

3. Pool virus samples from all tubes, gently mix, and place half the solution in each of two clear centrifuge tubes. Fill these with 1.35 g/cm3 CsCl in TE and centrifuge to equilibrium in the SW41 rotor for 20 h at 35,000 rpm (151,000g) at 4oC. The virus band will be found in the top one-third of the gradient (Fig. 1). Recover the virus as described above. For greater purity, repeat the centrifugation step using one gradient only.

3.5. Desalting Concentrated Virus

1. Place a Nap25 column (Amersham/Pharmacia) in a retort stand (wiped with 70% ethanol). Equilibrate the column by 3 x 5-mL applications of virus storage buffer item.

2. Mix and apply the viral band from the final gradient (<2 mL) to the equilibrated column. Allow the sample to run into the column; then apply 10 x 0.5-mL of virus storage buffer and collect the eluted fractions in sterile tubes.

3. Identify fractions containing the most virus using a PicoGreen binding assay (Molecular Probes, Eugene, OR) as follows:

a. Add 5 |L of each fraction to 100 |L of virus dissociation buffer followed by 100 |L of PicoGreen diluted 1:400 in deionized water. Include a blank with no virus added.

b. Mix well and add a 100 |L aliquot of each sample to individual wells of a black 96-well plate. Read the fluorescence at 485nm excitation/535nm emission in a fluorescent plate reader (Wallac Isoplate Victor2; Perkin Elmer).

c. Pool the three to four fractions with the highest PicoGreen readings, and mix gently but completely.

Fig. 1. Bands of OAdV623 after centrifugation to equilibrium on CsCl gradients.

4. Gently take up the virus in a 2.5-mL syringe using a 38-mm blunt-ended needle (18-gage; Terumo). Attach a filter unit (Millex GV 0.22-|im x 13-mm; Millipore) to the syringe, depress the plunger, and collect the filtered virus in sterile Eppendorf tubes. Remove 6 x 20-|L and 1 x 100-|L samples for quality control analysis; dispense the remainder of the virus in 2- to 300-|L aliquots and store at -80°C.

5. If desired, OAdV623 may be formulated with cationic lipid to facilitate infection of cells that have a low number of viral receptors.

a. Calculate the total volume of formulated virus required. In a polypropylene tube, dilute purified virus at 4°C with TSP to twice the final concentration desired, allowing for 5-10% overage.

b. In a glass vial, dilute CS087 in TSP to 20 ||M (twice the final concentration required) in half the final volume desired. Allow it to warm to room temperature.

c. Add one-half volume of OAdV623 in TSP to the glass vial and mix gently but thoroughly. Gently agitate the suspension at 40 rpm for 60-90 min at room temperature.

d. Store the formulated virus in 0.2-mL aliquots in 2-mL glass vials at -80°C. 3.6. Quality Control Assays

Below we summarize assays for the vector that are routinely used to verify identity, purity, and genetic stability. We also describe a new assay designed to measure vector potency. The latter is especially important because OAdV220 and OAdV623 carry the components of a cell killing system intended for the treatment of solid tumors.

Measure the pH of the virus preparation before freezing by placing a 20-|L droplet on the window of a precalibrated micro-pH meter (IFSET KS723,

Fig. 2. Analysis of OAdV623 by electron microscopy after negative staining. The bar represents 100 nm.

Shindengen Electric Mfg. Co. Ltd, Tokyo). It should be pH 8.0, but values between pH 6.5 and 8.3 have been obtained where the virus had satisfactory infectivity and potency.

3.6.2. Electron Microscopy

Monitor virus purity and integrity by negative staining and transmission electron microscopy. Desalt the 20 |L sample (to remove sucrose) by spinning it briefly (750g for 2 min) through a Microspin G-25 Column (Amersham/ Pharmacia) in an Eppendorf tube. Keep the purified sample on ice and have it processed as soon as possible by the electron microscopist. A typical OAdV preparation is shown in Fig. 2.

3.6.3. Virus Particle Number

The concentration of virus particles (vp) in a preparation can be determined as previously described (15).

1. Mix a 100-|L aliquot of the virus with an equal volume of virus dissociation buffer in an Eppendorf tube and heat at 65oC for 20 min.

2. Read the optical density (1-cm path length) at wavelengths of 310, 280, and 260 nm using a spectrophotometer (Shimadzu UV-1601) with buffer alone as blank. The OD310nm reading should be <0.02. The OD260nm reading should be in the range of >0.1 to <0.8. If >0.8, dilute the sample and read it again (see Note 3). The OD260/280nm ratio is usually between 1.19 and 1.25.

BSA 200 20

BSA 200 20

1

i™ -1

A--

!

A

<

_ _*

66.3

55.4

36.5

21.5

14.4

66.3

55.4

36.5

21.5

14.4

Fig. 3. Analysis of OAdV623 virus by SDS-PAGE. CsCl-purified virus (4 x 109vp/ lane) was analyzed on a 4-20% gradient gel. The horizontal arrow indicates the position of 32K protein, which stains poorly with silver. To obtain an estimate of virus purity, samples were spiked with known amounts of bovine serum albumin (BSA) as shown.

3. The concentration of virus particles is calculated from the OD260nm reading, assuming 1.3 x 1012 vp per OD260nm unit. This figure is based on the extinction coefficient determined for AdV5 (16) and takes into account the smaller genome size of OAdV (35,937 bp vs 29,575 bp, respectively).

3.6.4. Analysis of Viral Proteins

Virus purity is monitored by electrophoresis in SDS-polyacrylamide gels. CSL503 cell lysate diluted 1:16 to 1:64 may be used as a control for contamination by cellular proteins.

1. Heat the lysate, virus test, and reference samples (~4 x 109 vp per lane) and protein molecular-weight standards (e.g., Invitrogen Mark 12TM) at 98-100oC in an equal volume (15-25 |L) of gel loading buffer.

2. Cool and load the samples onto a 4-20% preformed gradient gel (Gradipore, French's Forest, NSW). Alternatively, an 8-18% gradient gel can be used.

3. Electrophorese samples in gel running buffer at 100 V until the indicator dye leaves the bottom of the gel and then for a further 20 min.

4. Viral proteins (Fig. 3) are detected by silver staining (SilverXpress, Invitrogen, Carslbad, CA) according to the instructions supplied with the kit.

3.6.5. Analysis by Restriction Enzyme Digestion

1. The nucleotide sequence of OAdV is known (Genbank Accession number U40839). As long as the nucleotide sequence of the inserted gene is also known, restriction digestion can be used to confirm the presence of that gene and the integrity of the OAdV genome. For OAdV623, BamHI and EcoRV are typically used.

2. Approximately 200-300 ng of viral DNA (from ~2 x 1010 vp) is required per digest. This is extracted by incubating the virus with an equal volume of pronase (1 mg/mL) in TE plus 1% SDS for 2 h at 37°C.

3. Samples are then extracted twice with phenol/chloroform (saturated with TE, pH 8.0) and once with ether.

4. The DNA is recovered by precipitation with sodium acetate pH 4.8 (1/10 volume) and ethanol (two volumes).

5. Samples are frozen on dry ice for 10 min and then spun at 15,000 rpm for 10 min to precipitate DNA.

6. Pellets are washed with 70% ethanol, spun at 15,000 rpm for 5 min, air-dried, and resuspended in TE, pH 8.0.

7. After digestion, the DNA fragments are resolved by electrophoresis on a 1% agarose gel and stained with ethidium bromide. The pattern of bands is compared to the theoretical sequence and/or a reference sample digested under the same conditions.

3.6.6. Identity by Polymerase Chain Reaction

This assay is designed to identify the full-length inserted gene cassette and to confirm the identity of OAdV623 virus particles. However, by choosing suitable primers, the assay can be adapted for any adenovirus vector. The test will also confirm that the gene cassette is free from any deletions and is in the correct position within the viral genome. The assay utilizes three primer pairs, two of which (primers 1 and 2, and 3 and 4) are able to amplify the ends of the gene cassette together with their respective viral flanking sequence, while the third pair (primers 5 and 6) targets a site remote from where the gene cassette has been inserted (in the DBP gene) and acts as a positive control for any false negatives in the polymerase chain reaction (PCR). By using only the two outer primers (1 and 4), which target the viral flanking sequence, the full-length gene cassette is amplified. Because smaller fragments are preferentially amplified in a PCR with any given set of primers, any deletion from within this gene cassette will be observed as products of smaller than expected size. The primers used for OAdV623 are shown in Table 1.

1. For PCR analysis, purified DNA or supernatants from infected cultures can be used. Virus in the latter is diluted 1:50 with water and boiled for 5 min in a 1.5-mL Eppendorf tube additionally sealed with parafilm tape.

2. Reactions are set up using Promega 2X Master mix, appropriate primer pairs (0.2 |iM each), template DNA (1 |L), and Taq polymerase according to standard procedures.

Table 1

Description of Primers Used in the PCR Identity Assay for OAdV623

Table 1

Description of Primers Used in the PCR Identity Assay for OAdV623

Primer

number

Primer name

Sequence (5' to 3')

1

5' flanking primer

AACCCATTGCGTTCCTCTAAGA

2

PSME

AACTTCCCTTTCCACTTCAACTACAT

3

BGH

CGCACTGGAATCCGTTCTG

4

3' flanking primer

TGGCCTGTATGTAATGCAGTTGT

4.1°

3' flanking primer

GGCACCTTCCAGGGTCAAG

5

5' DNA-binding protein

TCCGACTTTAGCTTTCGGAA

6

3' DNA-binding protein

CTATGGCTACTGTAGGAGGTAGAAT

"Primer 4.1 is an alternative to primer 4. It appears to have greater specificity and produces a product of 2592 bp.

PCR, polymerase chain reaction; PSME, pseudomembrane; BGH, bioassayable growth hormone.

"Primer 4.1 is an alternative to primer 4. It appears to have greater specificity and produces a product of 2592 bp.

PCR, polymerase chain reaction; PSME, pseudomembrane; BGH, bioassayable growth hormone.

3. Cycles of 94°C for 2 min (x1), 94°C for 30 s, 60°C for 30 s, and 68°C for 3 min (x40) were used.

4. The PCR product generated by primers 1 and 4 was 2857 bp in size (Fig. 4). The PCR products from primer pairs 1 and 2, and 3 and 4, were 263 and 399 bp in size, respectively (Fig. 4). The absence of either or both of these bands indicates possible rearrangement or deletion around the cloning site. The DBP product was 428 bp in size.

3.6.7. Infectivity

The infectious titer of virus test and reference samples is determined by a limiting dilution assay. Inclusion of the reference sample allows unexpected variability in the assay to be monitored. The assay uses CSL503 cells that are permissive for OAdV replication. These cells should not be passaged for more than 54 doublings.

1. Seed the cells (104/well) in all wells of two 96-well plates. This provides enough wells for duplicate assays of seven log10 dilutions in replicates of 12 with one row of uninfected cells.

2. After overnight incubation of cells at 37°C in 5% CO2, serially dilute the virus sample (1 in 104 to 1 in 1010) in MEM and supplements plus FBS.

3. Remove old medium from the cells and replace it with medium containing diluted virus. Incubate the cells for a week to obtain an interim result.

4. Inspect the wells under the microscope for development of CPE and score them as positive or negative. Incubate the cells for a further week to allow the full development of CPE, particularly in the highly diluted samples.

5. Calculate the TCID50/mL of test samples using methods originally described by Spearman and Karber (17,18). An example is provided in Table 2.

Lane 12 3 15

Fig. 4. Amplification of denatured OAdV623 virus DNA using the primers listed in Table 1. Lanes: (1) Lamda/Hindlll DNA markers; (2) 100 bp ladder DNA markers (100-1000 bp); (3) full gene cassette (expected size 2857 bp); (4) co-amplification of the gene cassette/insertion site junctions (expected sizes 263 and 399 bp); (5) DNA-binding protein (+) control amplification (expected size 428 bp).

Lane 12 3 15

Fig. 4. Amplification of denatured OAdV623 virus DNA using the primers listed in Table 1. Lanes: (1) Lamda/Hindlll DNA markers; (2) 100 bp ladder DNA markers (100-1000 bp); (3) full gene cassette (expected size 2857 bp); (4) co-amplification of the gene cassette/insertion site junctions (expected sizes 263 and 399 bp); (5) DNA-binding protein (+) control amplification (expected size 428 bp).

Table 2

Example of Analytical Test Sheet for TCID50 Determination

Table 2

Example of Analytical Test Sheet for TCID50 Determination

1

2

3

4

5

6

7

8

9

10

11

12

+

-

P

A-6a

+

+

+

+

+

+

+

+

+

+

+

+

12

0

1

B-7

+

+

+

+

+

+

+

+

+

+

+

+

12

0

1

C-8

+

+

+

+

+

+

+

+

+

+

+

+

12

0

1

D-9

+

-

-

+

+

-

-

-

+

-

+

-

5

7

0.41

E-10

-

-

+

-

-

-

-

-

-

-

-

-

1

11

0.08

F-11

0

12

0

G-12

0

12

0

aRow A, 10-fold dilution factor.

aRow A, 10-fold dilution factor.

Count and record the total number of CPE "+" and "-" wells for each row. Calculate the proportion positive in each row by dividing the number of positives by the total number in that row. Record the answer in the "p" column for that row. For example, in Table 2, row D, the proportion is equal to the positive wells in row D (5) divided by the total wells (12), which equals 0.4166. The log10 of the 50% end point (TCID50) in 100 ^L inoculum is given by X0 - (d/2) + d (Xpj), where X0 is the log of the reciprocal of the last dilution at which all wells are positive and d = log10 of the dilution factor (i.e., the difference between the dilution intervals. In this case d = 1), and pi are the proportions, p, that were calculated above, starting with the p-value corresponding to X0 and adding p-values from higher dilutions. Thus, from Table 2, X0 - (d/2) + d (Lp) = 8 - 1/2 + 1 + 0.4166 + 0.0833 = 9.0, but because

OD max A

OD min=Y0

Fig. 5. Example of a first-order exponential decay curve and an analysis of a particular batch of OAdV623.

0.1 mL of inoculum was used per well, log 1/0.1 = log 10 = 1 must be added to this figure. Taking the antilog of the total, the 50% end point (TCID50) titer is therefore 1 x 1010 TCID50/mL. The vp/TCID50 ratio can now be calculated. This is usually less than 40:1 and often less than 20:1 for individual virus preparations.

3.6.8. Functional Potency Assay

The potency of OAdV623 batches is measured in human prostate cancer PC3 cells using a cell killing assay. This quantifies cell death attributable to the combined outcome of infectivity, gene expression, and PNP activity in the presence of a pro-drug substrate, fludarabine phosphate. Cell viability is measured after 4 d by an MTS cytotoxicity assay. The cell-killing assay has been used for OAdV220, OAdV623, and FP253, but its principles can be adapted to other gene-directed enzyme pro-drug systems by using different vectors and cell lines. The outcome is expressed as the concentration of virus that corresponds to the "half-life" of the first-order exponential decay curve (VP50) (Fig. 5). The figure provides a measure of potency that allows different virus batches to be compared while a reference batch provides a measure of consistency across assays. The result should be consistent with results from other assays in the suite of tests.

3.6.8.1. Setting Up the Test Plates

One cell culture plate setup as described here is sufficient to test two virus samples in triplicate. Each sample is tested on two separate plates with a cell standard curve and a virus reference standard on each plate (see Note 4).

1. Harvest PC3 cells by gentle treatment with trypsin, resuspend them in RPMI plus supplements at 5 x 104 cells/mL, and place them in a sterile 30-mL dispensing trough.

OD max A

OD min=Y0

Fig. 5. Example of a first-order exponential decay curve and an analysis of a particular batch of OAdV623.

Table 3

Cell Standard Curve Dilution Platea

Table 3

Cell Standard Curve Dilution Platea

Volume of cell

Volume of

Total cells

Row no.

suspension/well (|L)

medium/well (| L)

per well

A

1000

0

50,000

B

800

200

40,000

C

600

400

30,000

D

400

600

20,000

E

200

800

10,000

F

100

900

5000

G

50

950

2500

H

0

1000

0

Total

280,000

"Sufficient cells to set up standard curves on three test plates.

"Sufficient cells to set up standard curves on three test plates.

Table 4

Number of Cells/Well in the Test Plate

Table 4

Number of Cells/Well in the Test Plate

Number of cells/well in columns 1-12

Test

Test

Reference

standard curve

sample 1

sample 2

Sample

1 2 3

4 5 6

7 8 9

10 11 12

2. Gently and thoroughly mix the cells and immediately dilute them for the cell standard curve in a plate as shown in Table 3.

3. Using a multichannel pipet (see Note 5), seed cells in the test plates in the following order (Table 4): (1) for test and reference samples, 5 x 103 cells/well (0.1 mL cell suspension) in columns 4-12 and rows A-H of all plates, seeding from top to bottom; (2) for cell standard curve, columns 1-3 and rows A-H of all plates, seed columns from left to right with 0.1 mL of diluted cells.

4. Cover and leave the plates at room temperature on a level surface for 15-30 min to allow the cells to settle evenly.

5. Wrap the edges of the plates in parafilm to prevent edge effects (such as drying out) on the cells and place them in an incubator overnight.

6. In preparation for transduction, gently aspirate the medium and replace it with 50 |L of RPMI (no serum) by adding it to the side of each well.

7. Return the cells to the incubator until the test and reference samples are ready.

3.6.8.2. Sample Preparation

1. Thaw the test and reference samples on wet ice and mix gently.

2. Using ice-cold TS buffer, dilute at least 10 |L of each test sample to 1 x 1010 vp/mL in a 1.5-mL polypropylene Eppendorf tube (see Note 6).

3. Using polypropylene microtiter plates with 250 |L wells (Greiner Bio-one), set up twofold serial dilutions of the samples in a dilution plate used for this purpose only. To 198 |L of serum-free medium in row A, columns 4-6 and 7-9, add 22 | L of each test sample at 1 x 1010 vp/mL according to the layout shown in Table 4.

4. Mix and dispense samples gently into the dilution medium using the multichannel pipet with the tip immersed.

5. Similarly, set up a twofold dilution series of the reference standard in row A, columns 10-12. Following dilution, the highest virus concentration in row A is 1 x 109 vp/mL. Using a multichannel pipet, carry out doubling dilutions down the plate for columns 4-12 by transferring a volume of 110 |L into the next row. At each transfer gently mix virus with the pipet twice. Discard the diluted virus taken from row G, thus leaving row H as a control without virus.

6. For the cell standard curve wells (columns 1-3), add 22 ||L TSP to 198 ||L serumfree medium in row A of the dilution plate. Make twofold dilutions down the plate to row G (medium only in row H). Transfer all samples to the cell transduc-tion plate without delay.

3.6.8.3. Transduction

1. Carefully remove the medium from the PC3 cells by gentle aspiration.

2. Dispense 100 |L from each well of the virus dilution plate into the corresponding well of the test plate using a multichannel pipet.

3. Add samples from the most dilute wells (row H) first, gently mixing up and down once at each row before transferring. The same set of tips should be used for the whole plate to reduce virus loss through adsorption to the tips.

4. Place infected cells in the incubator for 4 h.

3.6.8.4. Addition of Transgene Substrate

1. For each plate, prewarm 10.1 mL of RPMI plus 20% FBS and add a 100th volume of 1 mM fludarabine.

2. To the infected cells, add 100 |L of this medium containing pro-drug to all wells to give a final concentration of 5 |M (see Note 7).

3. Return the cells to the incubator for 4 d.

Table 5

Data Sets Generated by Microsoft Excel and Origin 7

From Analyses of Two Batches of OAdV623 and a Reference Batch

Table 5

Data Sets Generated by Microsoft Excel and Origin 7

From Analyses of Two Batches of OAdV623 and a Reference Batch

Origin

Cell standard

OAdV623

OAdV623

Reference

parameters

curve

sample 1

sample 2

standard

R2

1.00 (linear fit)

0.99

0.97

0.97

Y

0.26496

0.35133

0.34521

X0

0

0

0

A

0.78621

0.75718

0.61077

t

2.08 x 108

2.14 x 108

Result

ODmax VP50

3.6.8.5. Cell Viability Assay

Determine cell viability with an MTS assay (Promega Corp, Madison WI) carried out on day 4 according to the manufacturer's instructions.

1. For each test plate, mix MTS (2.2 mL) and PMS (110 |L) and prewarm RPMI plus 10% FBS (8.8 mL).

2. Gently aspirate the medium containing pro-drug from the cells, and replace it with 100 |L of medium containing MTS/PMS.

3. Incubate for 90-120 min and determine the OD492nm- OD650nm using a spectrophotometry plate reader (LabSystems Multiskan MS). If the highest reading is less than 0.8, save the data and incubate plates for up to 4 h, reading the plate at 30- to 45-min intervals. Ideally the highest reading should be ~1.0.

4. Export the data directly into a "Microsoft Excel" format for calculations.

3.6.8.6. Data Analysis and Acceptance Criteria

Prepare the data for analysis using a first-order exponential decay curve fit

(software: Origin version 7). For the standard cell curve and each test sample: calculate the mean (OD492 - OD650) values from the triplicate analyses and round them to two decimal places. Subtract the mean value for blank/background wells. Remove data points if a test well is contaminated, for example, with microorganisms. Plot the data for the cell standard curve to check that the cells did not overgrow (the curve should be essentially linear).

For the test samples, fit a first-order exponential decay curve to each dose-response curve using Origin 7 software (see examples in Table 5 and Fig. 6).

Fig. 6. Determination of the VP50 values for two batches of OAdV623 relative to a reference standard.

Use the equation Y = Y0 + Ae-[(X-X0)/t], where Y = OD492-650; X = vp/mL; Y0 = Y offset (ODmin); X0 = X offset; A = amplitude; t = decay constant (see Note 8). Set X0 = 0, Y0 > 0, and A > 0. Record the parameters Y0, A, t, and r2 from the Origin output in the Excel spreadsheet. Calculate the ODmax (OD492-650 reading that corresponds to no cell kill) and VP50 (concentration of test sample that corresponds to the "half-life" of the first order exponential decay curve) as follows:

If r2 > 0.90, calculate VP50 using VP50 = 0.693t.

If r2 < 0.90 and OD492-650 of the nil virus wells is within ± 10% of ODmaxcalc., reject the data set.

Sometimes wells without virus at the edge of the plate partially dry out, but it may still be possible to salvage meaningful data. If r2< 0.90 and OD492-650 of the nil virus wells is outside of ± 10% ODmaxcalc., remove data for nil virus wells and refit the curve using X0 = 0. If r2 > 0.90, calculate VP50. If r2< 0.90, reject the data set.

3.6.9. Other Tests

There are additional tests that can be done but that are not required for routine laboratory experimentation. For virus that is destined for preclinical toxicology or clinical studies, it is necessary to determine the level of contamination by host cell proteins. Similarly, the level of contamination by cellular DNA should be determined, although in contrast to immortalized cells (e.g., 293 cells used to propagate human AdV), CSL503 cells carry no known oncogenes. Virus samples must also be tested for the presence of endotoxin, residual CsCl, and bio-burden (see Note 9).

Was this article helpful?

0 0

Post a comment