The Importance of Selecting the Best Penetration Enhancers

The long-term goal of most research involving the transdermal delivery of AS-ODNs is to deliver them therapeutically. A great deal of effort is exerted to determine optimal delivery conditions as well as the best oligonucleotide sequence and structure. My laboratory examined the in vitro transdermal penetration of four oligonucleotides with different structures and chemistries to determine which could potentially be active in vivo. All studies used hairless mouse skin and followed the procedure described above.

The effect of a physical enhancement technique (iontophoresis) and a chemical penetration enhancer (90% PG and 10% LA) were examined for each oligo-nucleotide studied. The first oligonucleotide was a six base phosphorothioate telomere-mimic (MW = 1847) that inhibits telomerase activity with the sequence 5'-d(TTAGGG)-3' (TAG 6) (45). The next three antisense molecules examined were targeted to CYP3A2. The first was a phosphorodiamidate morpholine (MW = 8438) with the sequence 5'-(GAGCTGAAAGCAGGTCCATCCC)-3'. PMOs represent multiply modified DNA molecules in which the deoxyribose sugar is replaced with a six-member morpholine sugar. The backbone comprises nonionic phosphorodiamidate linkages. The second oligonucleotide tested was in the form of a ribozyme (MW = 13136), with the sequence 5'-fluoresceinyl-AGUGUGACUgaUgaGGCCGUGAGGCCgaaaGCUG AAAiT-3'. The capital letters represent 2'-O-allyl ribonucleotides. The lowercase letters represent ribonucleotides, and the 3'-end has an inverted thymi-dine linkage to protect from degradation by 3' exonucleases. The last antisense tested was a circle (MW = 11514) with the sequence 5'-GAAGAGAAttAAGA GAAGGGGGAGAAttAAGAGGGG-3'. The lowercase letters indicate the ends of the circle. A fluorescein was conjugated to one of the "t"s.

Fig. 1. In vitro cumulative absorption of four AS-ODN sequences when applied to hairless mouse skin in a donor solution containing 5 ^M antisense and 90% PG, 10% LA. (•) circle; (□) TAG6; (O) PMO; (A) ribozyme. The steady-state flux presented in Table 1 is calculated by obtaining the slope of the linear portion of the curve. Data are presented as the mean ± SEM.

Fig. 1. In vitro cumulative absorption of four AS-ODN sequences when applied to hairless mouse skin in a donor solution containing 5 ^M antisense and 90% PG, 10% LA. (•) circle; (□) TAG6; (O) PMO; (A) ribozyme. The steady-state flux presented in Table 1 is calculated by obtaining the slope of the linear portion of the curve. Data are presented as the mean ± SEM.

These oligonucleotides were selected for these studies because (1) they are biologically relevant with the potential for in vivo use, and (2) they represent four very different chemistries that have distinct behaviors in vivo. The phosphorothioates are somewhat nuclease resistant and act by recruiting RNase H to cut the mRNA that is bound (46). The ribozymes are catalytically active nucleic acids but are rapidly metabolized at requisite RNA linkage sites (47). The circle is a phosphodiester, and because there are no ends there is no degradation in the body, but efficacy requires triple helix formation to form the so-called "RNA clamp" (48). The PMOs are completely resistant to nucleases and are active via steric blockade of ribosomal assembly (49).

Figure 1 shows the transdermal penetration of each of these oligonucleotides in the presence of PG and LA from a 5 ^M donor solution. The passive penetration over 21 h was much greater for the circle (560 ± 33 pmol/cm2) and phosphorodiamidate morpholine (495 ± 176 pmol/cm2) than for the TAG6 (120 ± 27 pmol/cm2) and ribozyme (51 ± 18 pmol/cm2).

Table 1 compares the transdermal steady-state flux for each of these oligonucleotides when exposed to the skin using iontophoresis, PG and LA, and a buffer control. Figure 2 shows the transdermal penetration of TAG6 under these three conditions. The comparison demonstrates the importance of choosing appropriate techniques for penetration enhancement based on the chemistry of the molecule. Passive transdermal delivery for both the phosphorothioate and the circle was lowest when applied in a buffer solution. In both cases,

Table 1

Steady State Flux from Transdermal Delivery Through Hairless Mouse Skin In Vitro Using Iontophoresis, Chemical Enhancer, or Control

Table 1

Steady State Flux from Transdermal Delivery Through Hairless Mouse Skin In Vitro Using Iontophoresis, Chemical Enhancer, or Control

Oligonucleotide

Iontophoresis (pmol/[cm2h])

Passive:PG/LA (pmol/[cm2h])

Passive: Buffer (pmol/[cm2h])a

0 0

Post a comment