Introduction

Chinese hamster ovary (CHO) cells are the most frequently used cell lines for recombinant therapeutic protein production; however, only a little

genomic DNA sequence information is available for these cells. To identify unknown regions flanking a known DNA sequence by the genome walking method, researchers typically screen a genomic library with known DNA as a probe. However, the preparation and screening of libraries to obtain the desired DNA fragment takes a good deal of time. Recently, the polymerase chain reaction (PCR)-based methods have become popular, since the method is efficient and fast, and there is no need to construct and screen libraries. The currently available methods, such as inverse PCR (1), vectorette PCR (2), capture PCR (3), and adaptor-specific PCR (4, 5, 6, 7, 8) are effective but these methods need two-round PCR with gene- and adaptor-specific nested primers to amplify the flanking regions and reduce the non-specific amplification (9, 10).

To improve the amplification specificity, we designed a unique oligocassette consisting of two different length oligo-nucleotides, a 3'-end amino group modified short one and a hairpin-shaped longer one with the arbitrary gene-specific sequence. In this study, we can obtain the 2.3-kb genomic region coding the a-1, 6-fucosyltransferase (fut8) gene from CHO cells by one-round PCR with a single gene-specific primer.

2. MATERIALS AND METHODS

2.1 PCR primers and oligo-cassette units

The primers and oligo-cassette units used in this study are listed in Table 1 and Table 2, respectively.

Table 1. Primer sequences

fut8 P05 GCAGAGAGAAATCTCAGGGG

fut8 P10 ATACCTCCATCAGACTGGCC

fut8 P20 AGTTCCAGGACAGCTAGAGC

fut8 P23 TGGAAGGATGAAATCATTAGAAGGC

fut8 P30 TCTCAAAGTGGCTTGTTCTC

fut8 P40 GTTTCCCTAGACTATTATGGACAAC

fut8 P50 GCTAAAATATAGAATGGGGGAGGGG

fut8 P60 ACCACACACGTTAGGGTTCTACCTG

OC-P1 AAGGAAAAAAGCGGCCGCA

OC-P2 TTCCTTTTTTCGCCGGCGTTCGA

OC-P2PN PO2-TTCCTTTTTTCGCCGGCGTTCGA-NH2

OC-P3h TTCCAGTGGAAGGATGAAATCATTAGAAGGCAAGGAAAAAAGCGGCCGCA

For the amplification of different size fut8 fragments, eight primers (fut8 P05, fut8 P10, fut8 P20, fut8 23, fut8 P30, fut8 P40, fut8 P50, and fut8 P60) in known fut8 genomic sequence were synthesized, and they generated PCR fragments together with oligo-cassette-specific primers 0.5, 1.0, 2.0, 2.3, 3.0, 4.0, 5.0 and 6.0-kb, respectively.

For each conventional oligo-cassette unit, the annealing of the two primers OC-P1 and OC-P2 to form the unphosphorylated duplex oligocassette OC1 was performed by boiling 25 ^M of each primer solution, followed by slow cooling to room temperature.

For improved oligo-cassette units, a long primer, NHLPh10, was designed to have the same gene-specific sequences as fut8 P23 and to form the 5' overhang and hairpin structure. A short primer, OC-P2PN, was made from the modification of the phosphorylate at the 5'-end and the amino group at the 3'-end of the OC-P2.

Table 2. Modification and expected structure of oligo-cassette units

Name Oligomer

5'-P / 3'-N Structure

OC1 OC-P1

OC-P2

OC2 OC-P3h

OC-P2PN

n2h

P

P: 5'-end phosphorylated, N: 3'-end modification of amino group

P: 5'-end phosphorylated, N: 3'-end modification of amino group

2.2 Construction of oligo-cassette library

Both oligo-cassette units have the HindIII site, which was only added as a TCGA overhang that can combine with HindIII digested ends to form a full HindIII site. To reduce the probability of self-ligation and possible ligation of the oligo-cassette units attached to both ends of the digested DNA fragment, we performed digestion with two restriction enzymes. Approximately 2 ^g of CHO-K1 genomic DNA was double digested at 37 °C overnight using 10 units of HindIII and MunI in a 50 ^l reaction. Then, inactivation of the enzyme was carried out by heating to 65 °C for 20 min. For the construction of two oligo-cassette libraries, 4 ^l of HindIII and MunI digested genomic DNA was ligated to each oligo-cassette unit, OC1 and OC2, in a final volume of 8 ^l containing 3 units of T4 DNA ligase. This ligation reaction was incubated at 16°C overnight (16 - 18 hr), and then inactivation of the enzyme was carried out by heating to 70°C for 5 min. Individual oligo-cassette libraries were diluted 10-fold with TE buffer, and

1 ^l these diluted reactions was used as a PCR template. We constructed an OC1 oligo-cassette library derived from plasmid DNA that contains the cloned fut8 gene fragments isolated from genomic DNA, much like the construction of a genomic DNA library.

2.3 PCR amplifications

The amplification of the oligo-cassette libraries was performed with LA Taq DNA polymerase (TaKaRa) as recommended by the suppliers, in a GeneAmp PCR System 9700 (Applied Biosystems). In the case of the OC1 oligo-cassette library, 5 ng of the library was added to 25 ^l PCR amplification mixtures containing 1x LA Taq buffer (50 mM Tris-HCl, pH 9.3, 15 mM ammonium sulfate, and 2.5 mM MgCl2), 0.2 ^M fut8-specific primer (fut8 P05 - fut8 P60), 0.2 ^M cassette-specific primer (OC-P1), 2.5 units of LA Taq DNA polymerase and 400 ^M each dNTP. In the case of the OC2 oligo-cassette library, 5 ng of the library was added to 25 ^l PCR amplification mixtures containing 1 x LA Taq buffer (50 mM Tris-HCl, pH 9.3, 15 mM ammonium sulfate, and 2.5 mM MgCl2), 0.4 ^M fut8 P23 primer, 2.5 units of LA Taq DNA polymerase, and 200 ^M each dNTP. Standard PCR amplification was performed with the following temperature profile: after an initial denaturation step at 94°C for 5 min, 40 cycles of denaturation at 94°C for 30 s, annealing and extension at 62°C for 3 min, and final extension at 72°C for 7 min. On the other hand, gradient PCR amplification was set up at eight different annealing temperatures that ranged from 56 to 68°C in an iCycler (BIO-RAD), and the PCR temperature profile used was as follows: initial denaturation at 94°C for 4 min, 40 cycles of denaturation at 94°C for 30 s, annealing and extension at the desired temperature for 3 min, and final extension at 72°C for 7 min. The amplified products were separated in 0.8% agarose gel, stained with ethidium bromide, and visualized under UV light.

3. RESULTS AND DISCUSSION

3.1 Conventional oligo-cassette-ligated PCR

The basic outline of the oligo-cassette-mediated PCR, used in the present study to walk from a known sequences into flanking unknown sequences on the genomic DNA, is described in Fig. 1.

HindD _

HindD _

£ Restriction digestion

^ Ligation of oligo-cassette unit

J. Melting and annealing ^ ^

J. 1st cycle of PCR

\ Melting and annealing

J. 2nd cycle of PCR

^

S—1 PCR primer T Restriction enzyme site Oligo-cassette unit

Figure 1. The scheme of oligo-cassette-ligated PCR for genome walking.

To examine the amplification efficiency of LM-PCR with a conventional oligo-cassette unit, we amplified both cloned fut8 gene and genomic DNA libraries ligated with OC-1 by an oligo-cassette-specific primer (OC-P1, Table 1) and seven fut8 gene-specific primers (fut8 P05 - fut8 P60, Table 1). Specific products were observed in all gene-specific primers from the cloned fut8 gene library, even though non-specific bands appeared with primers for 5.0-kb and 6.0-kb fragments (Fig. 2a). On the other hand, no distinct products were observed in any primers from the genomic DNA library (Fig. 2b). In addition, there was no distinct PCR product from the oligo-cassette-ligated genomic DNA even if gene-specific primers were used (data not shown). This result suggests that the ligation of conventional design of oligo-cassette to genomic DNA decreases the specificity of PCR.

It has been reported that oligo-cassette-mediated PCR is an inefficient strategy because in most cases non-specific amplification accounts for the major proportion of the final PCR products. To resolve this problem, scientists have improved the process continually by employing different adaptors and cassettes, and several improved LM-PCRs have been reported (11). However, none of the improved methods could eliminate this drawback completely.

Figure 2. Comparison of target fragment sizes by oligo-cassette-mediated PCR using different templates; (a) plasmid DNA containing a fut8 fragment and (b) CHO genomic DNA. Both templates were digested with Hind III and then ligated with an oligo-cassette.

Figure 2. Comparison of target fragment sizes by oligo-cassette-mediated PCR using different templates; (a) plasmid DNA containing a fut8 fragment and (b) CHO genomic DNA. Both templates were digested with Hind III and then ligated with an oligo-cassette.

3.2 Improved oligo-cassette-ligated PCR

To improve the amplification specificity, we designed an OC2 oligocassette that has three improved points. One is the adoption of the hairpin structure in the longer strand. This may reduce possible ligation artifacts in the library by preventing the extension of the 3'-end of the cassette-ligated genomic fragment. Second is the 5'-end phosphorylation of the shorter oligo, OC-P2PN. This may not be shed from the end of the genomic DNA fragment during the PCR procedure. This also may prevent the non-specific annealing with floating primers. Last is the presence of an amino group on the 3'-end of the shorter strand. This may block all the available 3'-ends of the restriction fragments, thereby preventing the synthesis of a complementary strand on the longer 5' overhang end of the oligo-cassette and also preventing the creation of a gene-specific primer annealing site during PCR.

The improved 5' overhang oligo-cassette, OC2, library has the same sequence as the gene-specific primer, so no cassette-specific primer was required. This also may prevent non-specific amplification, because the complementary template can only be synthesized after the initial cycle of PCR is carried out by the gene-specific primer annealing to the target locus on template. Consequently, PCR amplification will not occur from the template when the oligo-cassette is attached to both ends of the genomic DNA fragment.

Using this improved oligo-cassette, we have successfully obtained a 2.3kb fragment at an annealing temperature of 58.5°C in the PCR (Fig.3). DNA sequences of this amplicon were in agreement with the desired target.

In the present study, we have succeeded in improving the specificity of oligo-cassette-mediated PCR. We were able to obtain the target fragment with only a primary PCR. This improved PCR procedure is probably possible in any gene or organism for which there is only a little chromosomal information available.

0 0

Post a comment