Late Gene Expression and Virus Assembly

Efficient late gene expression commences with the onset of Ad DNA replication. Late transcripts are initiated from the major late promoter (MLP) located at 16 map units (Fig. 1) [92], Activation of the major late promoter appears to be mediated by both cis-acting changes in the viral genome as well as trans-acting factors. Both cellular and viral trans-acting components have been identified that bind sequences within the major late promoter. Cellular transcription factors TBP/TF-IID, USF/MLTF, and CAT box factor interact with cis-acting elements upstream of the major late promoter initiation site and are important activators of MLP expression [93], Activation of the MLP also is specified by protein binding sites located downstream from the transcriptional start site [94], The trans-acting components binding these sites are not fully characterized, but constitute multiprotein complexes containing the virally encoded IVa2 protein [95]. Through a mechanism(s) that is not understood, the Ad replication process significantly stimulates the activity of the MLP.

The primary transcript from the major late promoter extends to the right end of the viral genome and is ~30,000 nucleotides (nt) in length. This primary transcript is polyadenylated at one of five sites and undergoes multiple splicing events to generate five families of late mRNAs (LI to L5; Fig. 1) [92], At least 18 distinct late mRNAs are produced by alternative polyadenylation and splicing of the primary major late transcript. The 5' ends of all Ad late mRNAs contain an ~200-nt leader sequence referred to as the tripartite leader (due to the joining of three short exons in the primary late transcript). The tripartite leader sequence directs efficient translation of Ad late mRNAs independent of the host cell initiation factor eIF4F [96, 97]. eIF4F

is a protein complex composed of phosphorylated cap-binding protein eIF4E, eIF4E kinase Mnkl, eIF4A, poly(A)-binding protein, and eIF4 G. Adenovirus infection blocks cellular translation by displacing Mnkl from eIF4F, thereby blocking phosphorylation of eIF4E [98]. The Ad-encoded 100K late protein binds to eIF4 G in the same region bound by Mnkl and displaces Mnkl from the eIF4F complex. This results in the shut off of translation of host mRNAs and Ad mRNAs that lack the tripartite leader sequence. The translation of Ad late mRNAs that carry the tripartite leader sequence continues, effectively shutting down host mRNA translation while permitting viral late mRNA translation. The mechanism by which translation of Ad late mRNAs continues despite inactivation of eIF4F is not fully understood. Ad late mRNAs encode proteins that are part of the Ad capsid structure (discussed in Chapter 1 of this volume), that are involved in the virus assembly process, or that play other regulatory roles during the late phase of virus infection.

Adenovirus DNA packaging into virus particles occurs in a polar manner from left to right and relies on a as-acting packaging domain located between approximately nt 200 and 380 nt (Fig. 6) (reviewed in [99]). It is thought that ds-acting packaging sequences and trans-acting protein components act in conjunction to mediate DNA packaging, similar to a number of bacteriophages like lambda or ^>29. The formation of Ad particles proceeds through an ggcgtaac CG gccatttt CG tctagggc CG accgttta CG

A1 A2 A3

GGATGTTGTAGTAAjATTTG)3GCGTAA(^C^GTAAGjATTTC^CCATTT^^CGGGAAAACTGAATAAGAGGAAGTGA/ijATCTG| 230 250 270 290 310

A4 A5 A6 A7

AATA^TTTTGtTGTTACTCATAGCGCGTAAllATTT

330 350 370

Figure 6 Schematic of the adenovirus DNA packaging domain. (A) A schematic diagram of the left end of the adenovirus genome including the inverted terminal repeat (ITR), the packaging/enhancer region (nts. 194 to 380), and the El A 5' flanking region. The packaging repeats (A1 through A7) are represented by arrows. The El A transcriptional start site is indicated by an arrow at nt 499. (B) The nucleotide sequence of the Ad5 packaging domain is shown. Numbers at the top correspond to nucleotides relative to the left end terminus. A repeats 1 through 7 are encircled. (C) The A repeat consensus sequence is shown.

Was this article helpful?

0 0

Post a comment